ID: 900480334

View in Genome Browser
Species Human (GRCh38)
Location 1:2895082-2895104
Sequence CCGCGCTGCTCCTCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900480326_900480334 12 Left 900480326 1:2895047-2895069 CCAGGCCTCTGCCGCCCGCGGCT No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480323_900480334 17 Left 900480323 1:2895042-2895064 CCATCCCAGGCCTCTGCCGCCCG No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480330_900480334 -2 Left 900480330 1:2895061-2895083 CCCGCGGCTGTGTGGTACACTCC No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480325_900480334 13 Left 900480325 1:2895046-2895068 CCCAGGCCTCTGCCGCCCGCGGC No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480331_900480334 -3 Left 900480331 1:2895062-2895084 CCGCGGCTGTGTGGTACACTCCG No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480327_900480334 7 Left 900480327 1:2895052-2895074 CCTCTGCCGCCCGCGGCTGTGTG No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data
900480329_900480334 1 Left 900480329 1:2895058-2895080 CCGCCCGCGGCTGTGTGGTACAC No data
Right 900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900480334 Original CRISPR CCGCGCTGCTCCTCGGCTCC TGG Intergenic
No off target data available for this crispr