ID: 900480798

View in Genome Browser
Species Human (GRCh38)
Location 1:2898222-2898244
Sequence CATCACAGGGGCACCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900480798_900480811 20 Left 900480798 1:2898222-2898244 CCCTCCATGGTGCCCCTGTGATG No data
Right 900480811 1:2898265-2898287 GCCAGGCACCCGTGAGTGAGTGG No data
900480798_900480808 3 Left 900480798 1:2898222-2898244 CCCTCCATGGTGCCCCTGTGATG No data
Right 900480808 1:2898248-2898270 GGGGCCCAAGGTCATCTGCCAGG No data
900480798_900480807 -9 Left 900480798 1:2898222-2898244 CCCTCCATGGTGCCCCTGTGATG No data
Right 900480807 1:2898236-2898258 CCTGTGATGTCAGGGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900480798 Original CRISPR CATCACAGGGGCACCATGGA GGG (reversed) Intergenic
No off target data available for this crispr