ID: 900481713

View in Genome Browser
Species Human (GRCh38)
Location 1:2902630-2902652
Sequence GTGGAGTGGGGTCCTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900481707_900481713 -6 Left 900481707 1:2902613-2902635 CCTCTCCTGGGTGCAGTGTGGAG No data
Right 900481713 1:2902630-2902652 GTGGAGTGGGGTCCTCTCCTGGG No data
900481698_900481713 24 Left 900481698 1:2902583-2902605 CCCTGTCGTGGGTGCGGTGTGGA No data
Right 900481713 1:2902630-2902652 GTGGAGTGGGGTCCTCTCCTGGG No data
900481699_900481713 23 Left 900481699 1:2902584-2902606 CCTGTCGTGGGTGCGGTGTGGAA No data
Right 900481713 1:2902630-2902652 GTGGAGTGGGGTCCTCTCCTGGG No data
900481706_900481713 -5 Left 900481706 1:2902612-2902634 CCCTCTCCTGGGTGCAGTGTGGA No data
Right 900481713 1:2902630-2902652 GTGGAGTGGGGTCCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900481713 Original CRISPR GTGGAGTGGGGTCCTCTCCT GGG Intergenic