ID: 900483027

View in Genome Browser
Species Human (GRCh38)
Location 1:2908548-2908570
Sequence GAGGCGTGGCCTAAGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900483027_900483034 24 Left 900483027 1:2908548-2908570 CCTCTGACCTTAGGCCACGCCTC No data
Right 900483034 1:2908595-2908617 GCTCCATGCTCCGCACAGTGAGG No data
900483027_900483031 2 Left 900483027 1:2908548-2908570 CCTCTGACCTTAGGCCACGCCTC No data
Right 900483031 1:2908573-2908595 TACTGTGCCTACACCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900483027 Original CRISPR GAGGCGTGGCCTAAGGTCAG AGG (reversed) Intergenic
No off target data available for this crispr