ID: 900483133

View in Genome Browser
Species Human (GRCh38)
Location 1:2909011-2909033
Sequence CACCCAGCTCTGGCTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900483128_900483133 4 Left 900483128 1:2908984-2909006 CCTGGGGCAGGTGGGGCTCTACT No data
Right 900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG No data
900483123_900483133 17 Left 900483123 1:2908971-2908993 CCAGGTCAGAGAACCTGGGGCAG No data
Right 900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900483133 Original CRISPR CACCCAGCTCTGGCTTCCAA GGG Intergenic
No off target data available for this crispr