ID: 900483134

View in Genome Browser
Species Human (GRCh38)
Location 1:2909012-2909034
Sequence ACCCAGCTCTGGCTTCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900483128_900483134 5 Left 900483128 1:2908984-2909006 CCTGGGGCAGGTGGGGCTCTACT No data
Right 900483134 1:2909012-2909034 ACCCAGCTCTGGCTTCCAAGGGG No data
900483123_900483134 18 Left 900483123 1:2908971-2908993 CCAGGTCAGAGAACCTGGGGCAG No data
Right 900483134 1:2909012-2909034 ACCCAGCTCTGGCTTCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900483134 Original CRISPR ACCCAGCTCTGGCTTCCAAG GGG Intergenic