ID: 900484892

View in Genome Browser
Species Human (GRCh38)
Location 1:2917822-2917844
Sequence GGACCCTCCCAGAGCACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900484892_900484899 9 Left 900484892 1:2917822-2917844 CCACGGGTGCTCTGGGAGGGTCC No data
Right 900484899 1:2917854-2917876 CTTCCAGCTTCTGCAGGCTCTGG No data
900484892_900484895 3 Left 900484892 1:2917822-2917844 CCACGGGTGCTCTGGGAGGGTCC No data
Right 900484895 1:2917848-2917870 TTGCCCCTTCCAGCTTCTGCAGG No data
900484892_900484901 26 Left 900484892 1:2917822-2917844 CCACGGGTGCTCTGGGAGGGTCC No data
Right 900484901 1:2917871-2917893 CTCTGGCTTTCCTTGACTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900484892 Original CRISPR GGACCCTCCCAGAGCACCCG TGG (reversed) Intergenic
No off target data available for this crispr