ID: 900484894

View in Genome Browser
Species Human (GRCh38)
Location 1:2917846-2917868
Sequence TGCAGAAGCTGGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900484894_900484902 9 Left 900484894 1:2917846-2917868 CCTTGCCCCTTCCAGCTTCTGCA No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484894_900484903 10 Left 900484894 1:2917846-2917868 CCTTGCCCCTTCCAGCTTCTGCA No data
Right 900484903 1:2917879-2917901 TTCCTTGACTCCCGGCCACAGGG No data
900484894_900484901 2 Left 900484894 1:2917846-2917868 CCTTGCCCCTTCCAGCTTCTGCA No data
Right 900484901 1:2917871-2917893 CTCTGGCTTTCCTTGACTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900484894 Original CRISPR TGCAGAAGCTGGAAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr