ID: 900484900

View in Genome Browser
Species Human (GRCh38)
Location 1:2917857-2917879
Sequence AAGCCAGAGCCTGCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900484900_900484901 -9 Left 900484900 1:2917857-2917879 CCAGCTTCTGCAGGCTCTGGCTT No data
Right 900484901 1:2917871-2917893 CTCTGGCTTTCCTTGACTCCCGG No data
900484900_900484902 -2 Left 900484900 1:2917857-2917879 CCAGCTTCTGCAGGCTCTGGCTT No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484900_900484903 -1 Left 900484900 1:2917857-2917879 CCAGCTTCTGCAGGCTCTGGCTT No data
Right 900484903 1:2917879-2917901 TTCCTTGACTCCCGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900484900 Original CRISPR AAGCCAGAGCCTGCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr