ID: 900484902

View in Genome Browser
Species Human (GRCh38)
Location 1:2917878-2917900
Sequence TTTCCTTGACTCCCGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900484894_900484902 9 Left 900484894 1:2917846-2917868 CCTTGCCCCTTCCAGCTTCTGCA No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484896_900484902 4 Left 900484896 1:2917851-2917873 CCCCTTCCAGCTTCTGCAGGCTC No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484897_900484902 3 Left 900484897 1:2917852-2917874 CCCTTCCAGCTTCTGCAGGCTCT No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484893_900484902 12 Left 900484893 1:2917843-2917865 CCTCCTTGCCCCTTCCAGCTTCT No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484900_900484902 -2 Left 900484900 1:2917857-2917879 CCAGCTTCTGCAGGCTCTGGCTT No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data
900484898_900484902 2 Left 900484898 1:2917853-2917875 CCTTCCAGCTTCTGCAGGCTCTG No data
Right 900484902 1:2917878-2917900 TTTCCTTGACTCCCGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900484902 Original CRISPR TTTCCTTGACTCCCGGCCAC AGG Intergenic
No off target data available for this crispr