ID: 900485659

View in Genome Browser
Species Human (GRCh38)
Location 1:2921440-2921462
Sequence CTGGATGGACAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485659_900485669 28 Left 900485659 1:2921440-2921462 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485669 1:2921491-2921513 ATCTGTCCATCCAGCTCTGCAGG No data
900485659_900485663 -10 Left 900485659 1:2921440-2921462 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485663 1:2921453-2921475 GTCCATCCAGCTCTGCAGGAGGG No data
900485659_900485665 -7 Left 900485659 1:2921440-2921462 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485665 1:2921456-2921478 CATCCAGCTCTGCAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485659 Original CRISPR CTGGATGGACAGATGGACAC AGG (reversed) Intergenic
No off target data available for this crispr