ID: 900485667

View in Genome Browser
Species Human (GRCh38)
Location 1:2921482-2921504
Sequence CTGGATGGACAGATGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485667_900485677 28 Left 900485667 1:2921482-2921504 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485677 1:2921533-2921555 GTCTGTCCATCCAGCTCTGCAGG No data
900485667_900485673 -7 Left 900485667 1:2921482-2921504 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485673 1:2921498-2921520 CATCCAGCTCTGCAGGAGGGCGG No data
900485667_900485671 -10 Left 900485667 1:2921482-2921504 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485671 1:2921495-2921517 GTCCATCCAGCTCTGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485667 Original CRISPR CTGGATGGACAGATGGACAG AGG (reversed) Intergenic
No off target data available for this crispr