ID: 900485683

View in Genome Browser
Species Human (GRCh38)
Location 1:2921566-2921588
Sequence CTGGATGGACAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485683_900485687 -10 Left 900485683 1:2921566-2921588 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485687 1:2921579-2921601 GTCCATCCAGCTCTGCAGGAGGG No data
900485683_900485693 28 Left 900485683 1:2921566-2921588 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485693 1:2921617-2921639 ATCTGTCCATCCAGCTCTGCAGG No data
900485683_900485689 -7 Left 900485683 1:2921566-2921588 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485689 1:2921582-2921604 CATCCAGCTCTGCAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485683 Original CRISPR CTGGATGGACAGATGGACAC AGG (reversed) Intergenic
No off target data available for this crispr