ID: 900485691

View in Genome Browser
Species Human (GRCh38)
Location 1:2921608-2921630
Sequence CTGGATGGACAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485691_900485695 -10 Left 900485691 1:2921608-2921630 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485695 1:2921621-2921643 GTCCATCCAGCTCTGCAGGAGGG No data
900485691_900485701 28 Left 900485691 1:2921608-2921630 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485701 1:2921659-2921681 ATCTGTCCATCCAGCTCTGCAGG No data
900485691_900485697 -7 Left 900485691 1:2921608-2921630 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485697 1:2921624-2921646 CATCCAGCTCTGCAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485691 Original CRISPR CTGGATGGACAGATGGACAC AGG (reversed) Intergenic
No off target data available for this crispr