ID: 900485699

View in Genome Browser
Species Human (GRCh38)
Location 1:2921650-2921672
Sequence CTGGATGGACAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485699_900485703 -10 Left 900485699 1:2921650-2921672 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485703 1:2921663-2921685 GTCCATCCAGCTCTGCAGGAGGG No data
900485699_900485710 28 Left 900485699 1:2921650-2921672 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485710 1:2921701-2921723 ATCTGTCCATCCAGCTCTGCAGG No data
900485699_900485705 -7 Left 900485699 1:2921650-2921672 CCTGTGTCCATCTGTCCATCCAG No data
Right 900485705 1:2921666-2921688 CATCCAGCTCTGCAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485699 Original CRISPR CTGGATGGACAGATGGACAC AGG (reversed) Intergenic
No off target data available for this crispr