ID: 900485753

View in Genome Browser
Species Human (GRCh38)
Location 1:2921902-2921924
Sequence CTGGATGGACAGATGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485753_900485759 -7 Left 900485753 1:2921902-2921924 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485759 1:2921918-2921940 CATCCAGCTCTGCAGGAGGGCGG No data
900485753_900485757 -10 Left 900485753 1:2921902-2921924 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485757 1:2921915-2921937 GTCCATCCAGCTCTGCAGGAGGG No data
900485753_900485763 28 Left 900485753 1:2921902-2921924 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485763 1:2921953-2921975 ATCTGTCCATCCAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485753 Original CRISPR CTGGATGGACAGATGGACAG AGG (reversed) Intergenic
No off target data available for this crispr