ID: 900485761

View in Genome Browser
Species Human (GRCh38)
Location 1:2921944-2921966
Sequence CTGGATGGACAGATGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485761_900485765 -10 Left 900485761 1:2921944-2921966 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485765 1:2921957-2921979 GTCCATCCAGCTCTGCAGGAGGG No data
900485761_900485767 -7 Left 900485761 1:2921944-2921966 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485767 1:2921960-2921982 CATCCAGCTCTGCAGGAGGGTGG No data
900485761_900485771 28 Left 900485761 1:2921944-2921966 CCTCTGTCCATCTGTCCATCCAG No data
Right 900485771 1:2921995-2922017 ATCTGTCTATCCAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485761 Original CRISPR CTGGATGGACAGATGGACAG AGG (reversed) Intergenic
No off target data available for this crispr