ID: 900485769

View in Genome Browser
Species Human (GRCh38)
Location 1:2921986-2922008
Sequence CTGGATAGACAGATGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900485769_900485778 22 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485778 1:2922031-2922053 TTGTCCATCCATCTGGGCTCTGG No data
900485769_900485773 -10 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485773 1:2921999-2922021 GTCTATCCAGCTCTGCAGGAGGG No data
900485769_900485780 24 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485780 1:2922033-2922055 GTCCATCCATCTGGGCTCTGGGG No data
900485769_900485779 23 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485779 1:2922032-2922054 TGTCCATCCATCTGGGCTCTGGG No data
900485769_900485776 16 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485776 1:2922025-2922047 CTGCCTTTGTCCATCCATCTGGG No data
900485769_900485775 15 Left 900485769 1:2921986-2922008 CCTCTGTCCATCTGTCTATCCAG No data
Right 900485775 1:2922024-2922046 GCTGCCTTTGTCCATCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900485769 Original CRISPR CTGGATAGACAGATGGACAG AGG (reversed) Intergenic
No off target data available for this crispr