ID: 900491023

View in Genome Browser
Species Human (GRCh38)
Location 1:2949219-2949241
Sequence CCGGCGACCTTGAATGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900491023_900491033 -2 Left 900491023 1:2949219-2949241 CCGCCATCATTCAAGGTCGCCGG No data
Right 900491033 1:2949240-2949262 GGGCGATGGGGCCGTGAATGGGG No data
900491023_900491031 -4 Left 900491023 1:2949219-2949241 CCGCCATCATTCAAGGTCGCCGG No data
Right 900491031 1:2949238-2949260 CCGGGCGATGGGGCCGTGAATGG No data
900491023_900491032 -3 Left 900491023 1:2949219-2949241 CCGCCATCATTCAAGGTCGCCGG No data
Right 900491032 1:2949239-2949261 CGGGCGATGGGGCCGTGAATGGG No data
900491023_900491037 22 Left 900491023 1:2949219-2949241 CCGCCATCATTCAAGGTCGCCGG No data
Right 900491037 1:2949264-2949286 CATTGGAAAGAAAATCGCTGTGG No data
900491023_900491034 5 Left 900491023 1:2949219-2949241 CCGCCATCATTCAAGGTCGCCGG No data
Right 900491034 1:2949247-2949269 GGGGCCGTGAATGGGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900491023 Original CRISPR CCGGCGACCTTGAATGATGG CGG (reversed) Intergenic
No off target data available for this crispr