ID: 900491298

View in Genome Browser
Species Human (GRCh38)
Location 1:2950430-2950452
Sequence CAGTTTCCCCAAATGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900491288_900491298 12 Left 900491288 1:2950395-2950417 CCAGAGCCCTGTAGTAATCGAGA No data
Right 900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG No data
900491290_900491298 6 Left 900491290 1:2950401-2950423 CCCTGTAGTAATCGAGAAGGCTG No data
Right 900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG No data
900491291_900491298 5 Left 900491291 1:2950402-2950424 CCTGTAGTAATCGAGAAGGCTGG No data
Right 900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG No data
900491287_900491298 13 Left 900491287 1:2950394-2950416 CCCAGAGCCCTGTAGTAATCGAG No data
Right 900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900491298 Original CRISPR CAGTTTCCCCAAATGCAGGT GGG Intergenic
No off target data available for this crispr