ID: 900494527

View in Genome Browser
Species Human (GRCh38)
Location 1:2970496-2970518
Sequence CCTTCTCTGCAGTGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900494514_900494527 4 Left 900494514 1:2970469-2970491 CCACTTTACCCTTCCCTGTCCTT No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494513_900494527 5 Left 900494513 1:2970468-2970490 CCCACTTTACCCTTCCCTGTCCT No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494517_900494527 -5 Left 900494517 1:2970478-2970500 CCTTCCCTGTCCTTGGCCCCTTC No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494512_900494527 13 Left 900494512 1:2970460-2970482 CCTGGGGGCCCACTTTACCCTTC No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494518_900494527 -9 Left 900494518 1:2970482-2970504 CCCTGTCCTTGGCCCCTTCTCTG No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494516_900494527 -4 Left 900494516 1:2970477-2970499 CCCTTCCCTGTCCTTGGCCCCTT No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data
900494519_900494527 -10 Left 900494519 1:2970483-2970505 CCTGTCCTTGGCCCCTTCTCTGC No data
Right 900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900494527 Original CRISPR CCTTCTCTGCAGTGGCTGGG CGG Intergenic
No off target data available for this crispr