ID: 900494934

View in Genome Browser
Species Human (GRCh38)
Location 1:2972031-2972053
Sequence CTCCTTCTCTGGCGGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900494911_900494934 21 Left 900494911 1:2971987-2972009 CCACCTGCCAGGGCCCAGGAAGG No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494913_900494934 18 Left 900494913 1:2971990-2972012 CCTGCCAGGGCCCAGGAAGGTGC No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494920_900494934 -7 Left 900494920 1:2972015-2972037 CCCACGGGGAGCCCTCCTCCTTC No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494916_900494934 8 Left 900494916 1:2972000-2972022 CCCAGGAAGGTGCTGCCCACGGG No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494918_900494934 7 Left 900494918 1:2972001-2972023 CCAGGAAGGTGCTGCCCACGGGG No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494914_900494934 14 Left 900494914 1:2971994-2972016 CCAGGGCCCAGGAAGGTGCTGCC No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data
900494921_900494934 -8 Left 900494921 1:2972016-2972038 CCACGGGGAGCCCTCCTCCTTCT No data
Right 900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900494934 Original CRISPR CTCCTTCTCTGGCGGGGGGG GGG Intergenic
No off target data available for this crispr