ID: 900497805

View in Genome Browser
Species Human (GRCh38)
Location 1:2984185-2984207
Sequence CATTCCCGGGGCTCCGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900497792_900497805 8 Left 900497792 1:2984154-2984176 CCGTGCAGTGGCTCAGAACCGCA No data
Right 900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG No data
900497789_900497805 16 Left 900497789 1:2984146-2984168 CCAGCCTCCCGTGCAGTGGCTCA No data
Right 900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG No data
900497791_900497805 9 Left 900497791 1:2984153-2984175 CCCGTGCAGTGGCTCAGAACCGC No data
Right 900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG No data
900497796_900497805 -10 Left 900497796 1:2984172-2984194 CCGCACCCCCGGGCATTCCCGGG No data
Right 900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG No data
900497790_900497805 12 Left 900497790 1:2984150-2984172 CCTCCCGTGCAGTGGCTCAGAAC No data
Right 900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900497805 Original CRISPR CATTCCCGGGGCTCCGTGGT GGG Intergenic
No off target data available for this crispr