ID: 900498049

View in Genome Browser
Species Human (GRCh38)
Location 1:2985315-2985337
Sequence GGCCGCATCTTCATTCCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498049_900498051 -5 Left 900498049 1:2985315-2985337 CCCGGTGGAATGAAGATGCGGCC No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498049_900498059 28 Left 900498049 1:2985315-2985337 CCCGGTGGAATGAAGATGCGGCC No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498049 Original CRISPR GGCCGCATCTTCATTCCACC GGG (reversed) Intergenic