ID: 900498050

View in Genome Browser
Species Human (GRCh38)
Location 1:2985316-2985338
Sequence GGGCCGCATCTTCATTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498050_900498059 27 Left 900498050 1:2985316-2985338 CCGGTGGAATGAAGATGCGGCCC No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498050_900498051 -6 Left 900498050 1:2985316-2985338 CCGGTGGAATGAAGATGCGGCCC No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498050 Original CRISPR GGGCCGCATCTTCATTCCAC CGG (reversed) Intergenic
No off target data available for this crispr