ID: 900498050 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:2985316-2985338 |
Sequence | GGGCCGCATCTTCATTCCAC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900498050_900498051 | -6 | Left | 900498050 | 1:2985316-2985338 | CCGGTGGAATGAAGATGCGGCCC | No data | ||
Right | 900498051 | 1:2985333-2985355 | CGGCCCCCCACCCTGAGTGCTGG | No data | ||||
900498050_900498059 | 27 | Left | 900498050 | 1:2985316-2985338 | CCGGTGGAATGAAGATGCGGCCC | No data | ||
Right | 900498059 | 1:2985366-2985388 | AGCCAGCTGCCGCCTTAGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900498050 | Original CRISPR | GGGCCGCATCTTCATTCCAC CGG (reversed) | Intergenic | ||