ID: 900498051

View in Genome Browser
Species Human (GRCh38)
Location 1:2985333-2985355
Sequence CGGCCCCCCACCCTGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498043_900498051 7 Left 900498043 1:2985303-2985325 CCCCCAATGCCGCCCGGTGGAAT No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498045_900498051 5 Left 900498045 1:2985305-2985327 CCCAATGCCGCCCGGTGGAATGA No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498049_900498051 -5 Left 900498049 1:2985315-2985337 CCCGGTGGAATGAAGATGCGGCC No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498038_900498051 22 Left 900498038 1:2985288-2985310 CCCTGCCAGGATCTTCCCCCAAT No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498039_900498051 21 Left 900498039 1:2985289-2985311 CCTGCCAGGATCTTCCCCCAATG No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498044_900498051 6 Left 900498044 1:2985304-2985326 CCCCAATGCCGCCCGGTGGAATG No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498047_900498051 -2 Left 900498047 1:2985312-2985334 CCGCCCGGTGGAATGAAGATGCG No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498046_900498051 4 Left 900498046 1:2985306-2985328 CCAATGCCGCCCGGTGGAATGAA No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498050_900498051 -6 Left 900498050 1:2985316-2985338 CCGGTGGAATGAAGATGCGGCCC No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data
900498040_900498051 17 Left 900498040 1:2985293-2985315 CCAGGATCTTCCCCCAATGCCGC No data
Right 900498051 1:2985333-2985355 CGGCCCCCCACCCTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498051 Original CRISPR CGGCCCCCCACCCTGAGTGC TGG Intergenic
No off target data available for this crispr