ID: 900498053

View in Genome Browser
Species Human (GRCh38)
Location 1:2985337-2985359
Sequence CTCACCAGCACTCAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498053_900498068 28 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498053_900498063 21 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498063 1:2985381-2985403 TAGCCCGGCCCCTCAGCCTCCGG No data
900498053_900498064 22 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498064 1:2985382-2985404 AGCCCGGCCCCTCAGCCTCCGGG No data
900498053_900498059 6 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498053_900498065 23 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498053 Original CRISPR CTCACCAGCACTCAGGGTGG GGG (reversed) Intergenic