ID: 900498055

View in Genome Browser
Species Human (GRCh38)
Location 1:2985339-2985361
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498055_900498063 19 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498063 1:2985381-2985403 TAGCCCGGCCCCTCAGCCTCCGG No data
900498055_900498064 20 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498064 1:2985382-2985404 AGCCCGGCCCCTCAGCCTCCGGG No data
900498055_900498059 4 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498055_900498065 21 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498055_900498068 26 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498055 Original CRISPR CTCTCACCAGCACTCAGGGT GGG (reversed) Intergenic