ID: 900498058

View in Genome Browser
Species Human (GRCh38)
Location 1:2985344-2985366
Sequence TGTGTCTCTCACCAGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498058_900498068 21 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498058_900498063 14 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498063 1:2985381-2985403 TAGCCCGGCCCCTCAGCCTCCGG No data
900498058_900498059 -1 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498058_900498065 16 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498058_900498064 15 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498064 1:2985382-2985404 AGCCCGGCCCCTCAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498058 Original CRISPR TGTGTCTCTCACCAGCACTC AGG (reversed) Intergenic
No off target data available for this crispr