ID: 900498059

View in Genome Browser
Species Human (GRCh38)
Location 1:2985366-2985388
Sequence AGCCAGCTGCCGCCTTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498053_900498059 6 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498057_900498059 0 Left 900498057 1:2985343-2985365 CCCTGAGTGCTGGTGAGAGACAC No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498055_900498059 4 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498054_900498059 5 Left 900498054 1:2985338-2985360 CCCCACCCTGAGTGCTGGTGAGA No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498052_900498059 7 Left 900498052 1:2985336-2985358 CCCCCCACCCTGAGTGCTGGTGA No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498049_900498059 28 Left 900498049 1:2985315-2985337 CCCGGTGGAATGAAGATGCGGCC No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498056_900498059 3 Left 900498056 1:2985340-2985362 CCACCCTGAGTGCTGGTGAGAGA No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498058_900498059 -1 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data
900498050_900498059 27 Left 900498050 1:2985316-2985338 CCGGTGGAATGAAGATGCGGCCC No data
Right 900498059 1:2985366-2985388 AGCCAGCTGCCGCCTTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498059 Original CRISPR AGCCAGCTGCCGCCTTAGCC CGG Intergenic
No off target data available for this crispr