ID: 900498060

View in Genome Browser
Species Human (GRCh38)
Location 1:2985368-2985390
Sequence GGCCGGGCTAAGGCGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498060_900498068 -3 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498060_900498065 -8 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498060_900498064 -9 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC No data
Right 900498064 1:2985382-2985404 AGCCCGGCCCCTCAGCCTCCGGG No data
900498060_900498063 -10 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC No data
Right 900498063 1:2985381-2985403 TAGCCCGGCCCCTCAGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498060 Original CRISPR GGCCGGGCTAAGGCGGCAGC TGG (reversed) Intergenic