ID: 900498065

View in Genome Browser
Species Human (GRCh38)
Location 1:2985383-2985405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498056_900498065 20 Left 900498056 1:2985340-2985362 CCACCCTGAGTGCTGGTGAGAGA No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498054_900498065 22 Left 900498054 1:2985338-2985360 CCCCACCCTGAGTGCTGGTGAGA No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498053_900498065 23 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498052_900498065 24 Left 900498052 1:2985336-2985358 CCCCCCACCCTGAGTGCTGGTGA No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498060_900498065 -8 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC 0: 1
1: 1
2: 1
3: 20
4: 259
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498058_900498065 16 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498057_900498065 17 Left 900498057 1:2985343-2985365 CCCTGAGTGCTGGTGAGAGACAC No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data
900498055_900498065 21 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498065 1:2985383-2985405 GCCCGGCCCCTCAGCCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type