ID: 900498068

View in Genome Browser
Species Human (GRCh38)
Location 1:2985388-2985410
Sequence GCCCCTCAGCCTCCGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498055_900498068 26 Left 900498055 1:2985339-2985361 CCCACCCTGAGTGCTGGTGAGAG No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498057_900498068 22 Left 900498057 1:2985343-2985365 CCCTGAGTGCTGGTGAGAGACAC No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498061_900498068 -10 Left 900498061 1:2985375-2985397 CCGCCTTAGCCCGGCCCCTCAGC No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498060_900498068 -3 Left 900498060 1:2985368-2985390 CCAGCTGCCGCCTTAGCCCGGCC 0: 1
1: 1
2: 1
3: 20
4: 259
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498058_900498068 21 Left 900498058 1:2985344-2985366 CCTGAGTGCTGGTGAGAGACACA No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498053_900498068 28 Left 900498053 1:2985337-2985359 CCCCCACCCTGAGTGCTGGTGAG No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498054_900498068 27 Left 900498054 1:2985338-2985360 CCCCACCCTGAGTGCTGGTGAGA No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498052_900498068 29 Left 900498052 1:2985336-2985358 CCCCCCACCCTGAGTGCTGGTGA No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data
900498056_900498068 25 Left 900498056 1:2985340-2985362 CCACCCTGAGTGCTGGTGAGAGA No data
Right 900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498068 Original CRISPR GCCCCTCAGCCTCCGGGGAG AGG Intergenic