ID: 900498256

View in Genome Browser
Species Human (GRCh38)
Location 1:2986703-2986725
Sequence CGTGCAAGGCTGCCCCCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900498246_900498256 23 Left 900498246 1:2986657-2986679 CCGTCTGGCAGCATGGTGGGTGT No data
Right 900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG No data
900498245_900498256 24 Left 900498245 1:2986656-2986678 CCCGTCTGGCAGCATGGTGGGTG No data
Right 900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG No data
900498251_900498256 -6 Left 900498251 1:2986686-2986708 CCTCAGCTGGTCCGCAGCGTGCA No data
Right 900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900498256 Original CRISPR CGTGCAAGGCTGCCCCCTCG GGG Intergenic
No off target data available for this crispr