ID: 900501029

View in Genome Browser
Species Human (GRCh38)
Location 1:3004728-3004750
Sequence CACAGAAGCGATTTCATGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900501025_900501029 -5 Left 900501025 1:3004710-3004732 CCCTGGGAGGCAGGAGTCCACAG No data
Right 900501029 1:3004728-3004750 CACAGAAGCGATTTCATGTTGGG No data
900501026_900501029 -6 Left 900501026 1:3004711-3004733 CCTGGGAGGCAGGAGTCCACAGA No data
Right 900501029 1:3004728-3004750 CACAGAAGCGATTTCATGTTGGG No data
900501021_900501029 11 Left 900501021 1:3004694-3004716 CCAGGGCTGTTGTGGGCCCTGGG No data
Right 900501029 1:3004728-3004750 CACAGAAGCGATTTCATGTTGGG No data
900501017_900501029 22 Left 900501017 1:3004683-3004705 CCGTCATACTGCCAGGGCTGTTG No data
Right 900501029 1:3004728-3004750 CACAGAAGCGATTTCATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900501029 Original CRISPR CACAGAAGCGATTTCATGTT GGG Intergenic