ID: 900501261

View in Genome Browser
Species Human (GRCh38)
Location 1:3005841-3005863
Sequence TGATTCTCAGGAGAGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900501261_900501267 26 Left 900501261 1:3005841-3005863 CCTCCAGGCTCTCCTGAGAATCA No data
Right 900501267 1:3005890-3005912 CTGCCAACACGTTTTCCAGTCGG No data
900501261_900501265 1 Left 900501261 1:3005841-3005863 CCTCCAGGCTCTCCTGAGAATCA No data
Right 900501265 1:3005865-3005887 AGTAAAATGTGGATGTTTCCAGG No data
900501261_900501264 -10 Left 900501261 1:3005841-3005863 CCTCCAGGCTCTCCTGAGAATCA No data
Right 900501264 1:3005854-3005876 CTGAGAATCACAGTAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900501261 Original CRISPR TGATTCTCAGGAGAGCCTGG AGG (reversed) Intergenic
No off target data available for this crispr