ID: 900502713

View in Genome Browser
Species Human (GRCh38)
Location 1:3014360-3014382
Sequence GCCGATGCACCCATGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502713_900502722 20 Left 900502713 1:3014360-3014382 CCCCAGGACATGGGTGCATCGGC No data
Right 900502722 1:3014403-3014425 TTAGCCCTTGAGTTTTCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502713 Original CRISPR GCCGATGCACCCATGTCCTG GGG (reversed) Intergenic
No off target data available for this crispr