ID: 900502881

View in Genome Browser
Species Human (GRCh38)
Location 1:3015258-3015280
Sequence GGCTGCAGGGACACTAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502881_900502892 15 Left 900502881 1:3015258-3015280 CCAGACTTAGTGTCCCTGCAGCC No data
Right 900502892 1:3015296-3015318 CCTCCTGCCTGTGTTCCTCCAGG No data
900502881_900502896 22 Left 900502881 1:3015258-3015280 CCAGACTTAGTGTCCCTGCAGCC No data
Right 900502896 1:3015303-3015325 CCTGTGTTCCTCCAGGGCAGAGG No data
900502881_900502893 16 Left 900502881 1:3015258-3015280 CCAGACTTAGTGTCCCTGCAGCC No data
Right 900502893 1:3015297-3015319 CTCCTGCCTGTGTTCCTCCAGGG No data
900502881_900502897 29 Left 900502881 1:3015258-3015280 CCAGACTTAGTGTCCCTGCAGCC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502881 Original CRISPR GGCTGCAGGGACACTAAGTC TGG (reversed) Intergenic
No off target data available for this crispr