ID: 900502885

View in Genome Browser
Species Human (GRCh38)
Location 1:3015279-3015301
Sequence AGGAGGGTGGTGGGAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502885_900502902 26 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502902 1:3015328-3015350 CCTGGTAGCTTGGCAGTGTCTGG No data
900502885_900502892 -6 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502892 1:3015296-3015318 CCTCCTGCCTGTGTTCCTCCAGG No data
900502885_900502896 1 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502896 1:3015303-3015325 CCTGTGTTCCTCCAGGGCAGAGG No data
900502885_900502893 -5 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502893 1:3015297-3015319 CTCCTGCCTGTGTTCCTCCAGGG No data
900502885_900502903 27 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502903 1:3015329-3015351 CTGGTAGCTTGGCAGTGTCTGGG No data
900502885_900502900 16 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502885_900502897 8 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502885 Original CRISPR AGGAGGGTGGTGGGAGGACC AGG (reversed) Intergenic
No off target data available for this crispr