ID: 900502887

View in Genome Browser
Species Human (GRCh38)
Location 1:3015288-3015310
Sequence AACACAGGCAGGAGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502887_900502900 7 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502887_900502897 -1 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502887_900502903 18 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502903 1:3015329-3015351 CTGGTAGCTTGGCAGTGTCTGGG No data
900502887_900502902 17 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502902 1:3015328-3015350 CCTGGTAGCTTGGCAGTGTCTGG No data
900502887_900502896 -8 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502896 1:3015303-3015325 CCTGTGTTCCTCCAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502887 Original CRISPR AACACAGGCAGGAGGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr