ID: 900502889

View in Genome Browser
Species Human (GRCh38)
Location 1:3015292-3015314
Sequence GAGGAACACAGGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502889_900502897 -5 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502889_900502900 3 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502889_900502903 14 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502903 1:3015329-3015351 CTGGTAGCTTGGCAGTGTCTGGG No data
900502889_900502902 13 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502902 1:3015328-3015350 CCTGGTAGCTTGGCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502889 Original CRISPR GAGGAACACAGGCAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr