ID: 900502890

View in Genome Browser
Species Human (GRCh38)
Location 1:3015295-3015317
Sequence CTGGAGGAACACAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502890_900502897 -8 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502890_900502902 10 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502902 1:3015328-3015350 CCTGGTAGCTTGGCAGTGTCTGG No data
900502890_900502900 0 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502890_900502903 11 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502903 1:3015329-3015351 CTGGTAGCTTGGCAGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502890 Original CRISPR CTGGAGGAACACAGGCAGGA GGG (reversed) Intergenic