ID: 900502897

View in Genome Browser
Species Human (GRCh38)
Location 1:3015310-3015332
Sequence TCCTCCAGGGCAGAGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502889_900502897 -5 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502884_900502897 15 Left 900502884 1:3015272-3015294 CCTGCAGCCTGGTCCTCCCACCA No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502886_900502897 2 Left 900502886 1:3015285-3015307 CCTCCCACCACCCTCCTGCCTGT No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502883_900502897 16 Left 900502883 1:3015271-3015293 CCCTGCAGCCTGGTCCTCCCACC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502888_900502897 -2 Left 900502888 1:3015289-3015311 CCACCACCCTCCTGCCTGTGTTC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502891_900502897 -9 Left 900502891 1:3015296-3015318 CCTCCTGCCTGTGTTCCTCCAGG No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502890_900502897 -8 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502887_900502897 -1 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502881_900502897 29 Left 900502881 1:3015258-3015280 CCAGACTTAGTGTCCCTGCAGCC No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data
900502885_900502897 8 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502897 1:3015310-3015332 TCCTCCAGGGCAGAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502897 Original CRISPR TCCTCCAGGGCAGAGGTGCC TGG Intergenic
No off target data available for this crispr