ID: 900502900

View in Genome Browser
Species Human (GRCh38)
Location 1:3015318-3015340
Sequence GGCAGAGGTGCCTGGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900502887_900502900 7 Left 900502887 1:3015288-3015310 CCCACCACCCTCCTGCCTGTGTT No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502891_900502900 -1 Left 900502891 1:3015296-3015318 CCTCCTGCCTGTGTTCCTCCAGG No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502895_900502900 -8 Left 900502895 1:3015303-3015325 CCTGTGTTCCTCCAGGGCAGAGG No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502890_900502900 0 Left 900502890 1:3015295-3015317 CCCTCCTGCCTGTGTTCCTCCAG No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502894_900502900 -4 Left 900502894 1:3015299-3015321 CCTGCCTGTGTTCCTCCAGGGCA No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502883_900502900 24 Left 900502883 1:3015271-3015293 CCCTGCAGCCTGGTCCTCCCACC No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502885_900502900 16 Left 900502885 1:3015279-3015301 CCTGGTCCTCCCACCACCCTCCT No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502884_900502900 23 Left 900502884 1:3015272-3015294 CCTGCAGCCTGGTCCTCCCACCA No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502889_900502900 3 Left 900502889 1:3015292-3015314 CCACCCTCCTGCCTGTGTTCCTC No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502886_900502900 10 Left 900502886 1:3015285-3015307 CCTCCCACCACCCTCCTGCCTGT No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data
900502888_900502900 6 Left 900502888 1:3015289-3015311 CCACCACCCTCCTGCCTGTGTTC No data
Right 900502900 1:3015318-3015340 GGCAGAGGTGCCTGGTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900502900 Original CRISPR GGCAGAGGTGCCTGGTAGCT TGG Intergenic
No off target data available for this crispr