ID: 900505613

View in Genome Browser
Species Human (GRCh38)
Location 1:3028666-3028688
Sequence AGAGTGGGGCGGCCCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900505600_900505613 16 Left 900505600 1:3028627-3028649 CCAGAGTTGACCCAAGGGTCACT No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data
900505602_900505613 5 Left 900505602 1:3028638-3028660 CCAAGGGTCACTGCTGACTCCGG No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data
900505601_900505613 6 Left 900505601 1:3028637-3028659 CCCAAGGGTCACTGCTGACTCCG No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data
900505596_900505613 29 Left 900505596 1:3028614-3028636 CCCGCTTGGGAGACCAGAGTTGA No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data
900505597_900505613 28 Left 900505597 1:3028615-3028637 CCGCTTGGGAGACCAGAGTTGAC No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data
900505595_900505613 30 Left 900505595 1:3028613-3028635 CCCCGCTTGGGAGACCAGAGTTG No data
Right 900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900505613 Original CRISPR AGAGTGGGGCGGCCCACAGC AGG Intergenic