ID: 900507598

View in Genome Browser
Species Human (GRCh38)
Location 1:3037423-3037445
Sequence TGGTCTCCTTCCCCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507598_900507612 30 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507612 1:3037476-3037498 GGTGACACGTGCGCAAGGGAGGG No data
900507598_900507606 3 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507606 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
900507598_900507609 25 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507598_900507611 29 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507611 1:3037475-3037497 AGGTGACACGTGCGCAAGGGAGG No data
900507598_900507604 -3 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507604 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
900507598_900507607 9 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507607 1:3037455-3037477 GGTACCAAGGGTAGCGGCTGAGG No data
900507598_900507602 -4 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507602 1:3037442-3037464 ACCACGACCAACGGGTACCAAGG No data
900507598_900507610 26 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507610 1:3037472-3037494 CTGAGGTGACACGTGCGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507598 Original CRISPR TGGTCTCCTTCCCCAGAGGA AGG (reversed) Intergenic