ID: 900507599

View in Genome Browser
Species Human (GRCh38)
Location 1:3037427-3037449
Sequence GTCGTGGTCTCCTTCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507599_900507612 26 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507612 1:3037476-3037498 GGTGACACGTGCGCAAGGGAGGG No data
900507599_900507610 22 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507610 1:3037472-3037494 CTGAGGTGACACGTGCGCAAGGG No data
900507599_900507607 5 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507607 1:3037455-3037477 GGTACCAAGGGTAGCGGCTGAGG No data
900507599_900507613 27 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507613 1:3037477-3037499 GTGACACGTGCGCAAGGGAGGGG No data
900507599_900507604 -7 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507604 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
900507599_900507609 21 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507599_900507602 -8 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507602 1:3037442-3037464 ACCACGACCAACGGGTACCAAGG No data
900507599_900507611 25 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507611 1:3037475-3037497 AGGTGACACGTGCGCAAGGGAGG No data
900507599_900507606 -1 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507606 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507599 Original CRISPR GTCGTGGTCTCCTTCCCCAG AGG (reversed) Intergenic