ID: 900507603

View in Genome Browser
Species Human (GRCh38)
Location 1:3037443-3037465
Sequence CCCTTGGTACCCGTTGGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507603_900507609 5 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507603_900507614 17 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507614 1:3037483-3037505 CGTGCGCAAGGGAGGGGCAGAGG No data
900507603_900507615 27 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507615 1:3037493-3037515 GGAGGGGCAGAGGCAGCATTTGG No data
900507603_900507612 10 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507612 1:3037476-3037498 GGTGACACGTGCGCAAGGGAGGG No data
900507603_900507613 11 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507613 1:3037477-3037499 GTGACACGTGCGCAAGGGAGGGG No data
900507603_900507610 6 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507610 1:3037472-3037494 CTGAGGTGACACGTGCGCAAGGG No data
900507603_900507611 9 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507611 1:3037475-3037497 AGGTGACACGTGCGCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507603 Original CRISPR CCCTTGGTACCCGTTGGTCG TGG (reversed) Intergenic