ID: 900507605

View in Genome Browser
Species Human (GRCh38)
Location 1:3037449-3037471
Sequence CCGCTACCCTTGGTACCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507605_900507613 5 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507613 1:3037477-3037499 GTGACACGTGCGCAAGGGAGGGG No data
900507605_900507611 3 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507611 1:3037475-3037497 AGGTGACACGTGCGCAAGGGAGG No data
900507605_900507610 0 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507610 1:3037472-3037494 CTGAGGTGACACGTGCGCAAGGG No data
900507605_900507609 -1 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507605_900507614 11 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507614 1:3037483-3037505 CGTGCGCAAGGGAGGGGCAGAGG No data
900507605_900507612 4 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507612 1:3037476-3037498 GGTGACACGTGCGCAAGGGAGGG No data
900507605_900507616 30 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507616 1:3037502-3037524 GAGGCAGCATTTGGCCCCATCGG No data
900507605_900507615 21 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507615 1:3037493-3037515 GGAGGGGCAGAGGCAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507605 Original CRISPR CCGCTACCCTTGGTACCCGT TGG (reversed) Intergenic