ID: 900507609

View in Genome Browser
Species Human (GRCh38)
Location 1:3037471-3037493
Sequence GCTGAGGTGACACGTGCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507599_900507609 21 Left 900507599 1:3037427-3037449 CCTCTGGGGAAGGAGACCACGAC No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507605_900507609 -1 Left 900507605 1:3037449-3037471 CCAACGGGTACCAAGGGTAGCGG No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507598_900507609 25 Left 900507598 1:3037423-3037445 CCTTCCTCTGGGGAAGGAGACCA No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data
900507603_900507609 5 Left 900507603 1:3037443-3037465 CCACGACCAACGGGTACCAAGGG No data
Right 900507609 1:3037471-3037493 GCTGAGGTGACACGTGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507609 Original CRISPR GCTGAGGTGACACGTGCGCA AGG Intergenic